proprietary software graphpad instat version 7.0b Search Results


resource source identifier mouse  (Jackson Laboratory)
86
Jackson Laboratory resource source identifier mouse
Resource Source Identifier Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/proprietary+software+graphpad+instat+version+7%2E0b/identifier+mouse+resource+source/pm32931754-221-2-7
Average 86 stars, based on 1 article reviews
resource source identifier mouse - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
mouse  (Jackson Laboratory)
86
Jackson Laboratory mouse
Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/proprietary+software+graphpad+instat+version+7%2E0b/mouse/pm32931754-221-40-42
Average 86 stars, based on 1 article reviews
mouse - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
b6 cg  (Jackson Laboratory)
86
Jackson Laboratory b6 cg
B6 Cg, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/proprietary+software+graphpad+instat+version+7%2E0b/26sortm14+b6+cag+cg+gt+hze+j+rosa+tdtomato/pm32931754-221-27-28
Average 86 stars, based on 1 article reviews
b6 cg - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
agaaggcagtcgtgagcttgca origene  (OriGene)
90
OriGene agaaggcagtcgtgagcttgca origene
Agaaggcagtcgtgagcttgca Origene, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/proprietary+software+graphpad+instat+version+7%2E0b/Cx3cr1+Mouse+qPCR+Primer+Pair/pm32931754-221-104-105
Average 90 stars, based on 1 article reviews
agaaggcagtcgtgagcttgca origene - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
cattgaccgctacctgaagacc origene  (OriGene)
93
OriGene cattgaccgctacctgaagacc origene
Cattgaccgctacctgaagacc Origene, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/proprietary+software+graphpad+instat+version+7%2E0b/P2ry12+Mouse+qPCR+Primer+Pair/pm32931754-221-112-113
Average 93 stars, based on 1 article reviews
cattgaccgctacctgaagacc origene - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
ctgtggtcatgag cccttc origene  (OriGene)
94
OriGene ctgtggtcatgag cccttc origene
Ctgtggtcatgag Cccttc Origene, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/proprietary+software+graphpad+instat+version+7%2E0b/Gapdh+Mouse+qPCR+Primer+Pair/pm32931754-221-69-71
Average 94 stars, based on 1 article reviews
ctgtggtcatgag cccttc origene - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier
beth stevens n a oligonucleotides qpcr primer  (OriGene)
97
OriGene beth stevens n a oligonucleotides qpcr primer
Beth Stevens N A Oligonucleotides Qpcr Primer, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/proprietary+software+graphpad+instat+version+7%2E0b/Primer/pm32931754-221-51-61
Average 97 stars, based on 1 article reviews
beth stevens n a oligonucleotides qpcr primer - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier
tnfsf12 tweak  (OriGene)
90
OriGene tnfsf12 tweak
Figure 5. Microglial <t>TWEAK</t> Signals through Postsynaptic Fn14 to Decrease Bulbous Spine Numbers (A) Example images of spines in the dLGNs of Fn14fl/flCre-negative or VGLUT2-Cre-positive mice following viral infection. Scale bar, 2 mm. (B) Quantification of bulbous spine densities following TWEAK or mCherry expression in the dLGNs of Cre-negative () and VGLUT2-Cre-positive (+) mice. A comparison of mCherry-infected conditions is also plotted in Figure 2D. (C) Example images of spines in the dLGNs of TWEAKfl/flCre-negative or Cx3cr1-Cre-positive mice. Scale bar, 2 mm. (D) Bulbous spine density is increased by genetic ablation of TWEAK in microglia. (E) Spine head diameter is increased by genetic ablation of TWEAK in microglia. (F) Thin spine density is unaffected by genetic ablation of TWEAK in microglia. (G) Non-bulbous spine density is unaffected by genetic ablation of TWEAK in microglia. (H) Total spine density is unaffected by genetic ablation of TWEAK in microglia. (I) Spine length is unaffected by genetic ablation of TWEAK in microglia. (J) Confocal images of dLGNs from a TWEAK KO mouse, a Fn14fl/flCre-negative mouse, and a Fn14fl/fl; VGLUT2-Cre+ mouse following bath application of recombinant mouse TWEAK and subsequent immunostaining for TWEAK (red) and VGLUT2 (green). Scale bar, 10 mm. (K) Western blot of whole mouse forebrain fractionated to enrich for synaptosomes. Blots were probed for Fn14, the retinal presynaptic marker VGLUT2, the postsynaptic marker PSD-95, and GAPDH (a non-synaptic control). (legend continued on next page)
Tnfsf12 Tweak, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/proprietary+software+graphpad+instat+version+7%2E0b/Tnfsf13+(BC069900)+Mouse+Tagged+ORF+Clone/pm32931754-221-86-97
Average 90 stars, based on 1 article reviews
tnfsf12 tweak - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Figure 5. Microglial TWEAK Signals through Postsynaptic Fn14 to Decrease Bulbous Spine Numbers (A) Example images of spines in the dLGNs of Fn14fl/flCre-negative or VGLUT2-Cre-positive mice following viral infection. Scale bar, 2 mm. (B) Quantification of bulbous spine densities following TWEAK or mCherry expression in the dLGNs of Cre-negative () and VGLUT2-Cre-positive (+) mice. A comparison of mCherry-infected conditions is also plotted in Figure 2D. (C) Example images of spines in the dLGNs of TWEAKfl/flCre-negative or Cx3cr1-Cre-positive mice. Scale bar, 2 mm. (D) Bulbous spine density is increased by genetic ablation of TWEAK in microglia. (E) Spine head diameter is increased by genetic ablation of TWEAK in microglia. (F) Thin spine density is unaffected by genetic ablation of TWEAK in microglia. (G) Non-bulbous spine density is unaffected by genetic ablation of TWEAK in microglia. (H) Total spine density is unaffected by genetic ablation of TWEAK in microglia. (I) Spine length is unaffected by genetic ablation of TWEAK in microglia. (J) Confocal images of dLGNs from a TWEAK KO mouse, a Fn14fl/flCre-negative mouse, and a Fn14fl/fl; VGLUT2-Cre+ mouse following bath application of recombinant mouse TWEAK and subsequent immunostaining for TWEAK (red) and VGLUT2 (green). Scale bar, 10 mm. (K) Western blot of whole mouse forebrain fractionated to enrich for synaptosomes. Blots were probed for Fn14, the retinal presynaptic marker VGLUT2, the postsynaptic marker PSD-95, and GAPDH (a non-synaptic control). (legend continued on next page)

Journal: Neuron

Article Title: Sensory Experience Engages Microglia to Shape Neural Connectivity through a Non-Phagocytic Mechanism.

doi: 10.1016/j.neuron.2020.08.002

Figure Lengend Snippet: Figure 5. Microglial TWEAK Signals through Postsynaptic Fn14 to Decrease Bulbous Spine Numbers (A) Example images of spines in the dLGNs of Fn14fl/flCre-negative or VGLUT2-Cre-positive mice following viral infection. Scale bar, 2 mm. (B) Quantification of bulbous spine densities following TWEAK or mCherry expression in the dLGNs of Cre-negative () and VGLUT2-Cre-positive (+) mice. A comparison of mCherry-infected conditions is also plotted in Figure 2D. (C) Example images of spines in the dLGNs of TWEAKfl/flCre-negative or Cx3cr1-Cre-positive mice. Scale bar, 2 mm. (D) Bulbous spine density is increased by genetic ablation of TWEAK in microglia. (E) Spine head diameter is increased by genetic ablation of TWEAK in microglia. (F) Thin spine density is unaffected by genetic ablation of TWEAK in microglia. (G) Non-bulbous spine density is unaffected by genetic ablation of TWEAK in microglia. (H) Total spine density is unaffected by genetic ablation of TWEAK in microglia. (I) Spine length is unaffected by genetic ablation of TWEAK in microglia. (J) Confocal images of dLGNs from a TWEAK KO mouse, a Fn14fl/flCre-negative mouse, and a Fn14fl/fl; VGLUT2-Cre+ mouse following bath application of recombinant mouse TWEAK and subsequent immunostaining for TWEAK (red) and VGLUT2 (green). Scale bar, 10 mm. (K) Western blot of whole mouse forebrain fractionated to enrich for synaptosomes. Blots were probed for Fn14, the retinal presynaptic marker VGLUT2, the postsynaptic marker PSD-95, and GAPDH (a non-synaptic control). (legend continued on next page)

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: B6.129P2(Cg)-Cx3cr1tm1Litt/J The Jackson Laboratory 005582; RRID:IMSR_JAX:005582 Mouse: Slc17a6tm2(cre)Lowl/J The Jackson Laboratory 028863; RRID:IMSR_JAX:016963 Mouse: Tg(Prkcd-glc-1/CFP,-Cre) Haubensak et al., 2010 N/A Mouse: B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J The Jackson Laboratory 007914; RRID:IMSR_JAX:007914 Mouse: Tg(Chx10-EGFP/cre,-ALPP)2Clc/J The Jackson Laboratory 005105; RRID:IMSR_JAX:005105 Mouse: B6J.B6N(Cg)-Cx3cr1tm1.1(cre)Jung/J The Jackson Laboratory 025524; RRID:IMSR_JAX:025524 Mouse: B6.C1qa(KO) Lab of Beth Stevens N/A Oligonucleotides qPCR primer: Gapdh (Forward): GGGTGTGAACCACG AGAAATA Origene Cat #: MP205604 qPCR primer: Gapdh (Reverse): CTGTGGTCATGAG CCCTTC Origene Cat #: MP205604 qPCR primer: Tnfsf12 (TWEAK) (Forward): GCTGGGC AACGCTGTCT Biogen N/A qPCR primer: Tnfsf12 (TWEAK) (Reverse): GCGGTCC TCTGCTGTCA Biogen N/A qPCR: Cx3cr1 (Forward): GAGCATCACTGACATCTACCTCC Origene Cat #: MP202408 qPCR: Cx3cr1 (Reverse): AGAAGGCAGTCGTGAGCTTGCA Origene Cat #: MP202408 qPCR: P2ry12 (Forward): CATTGACCGCTACCTGAAGACC Origene Cat #: MP212229 qPCR: P2ry12 (Reverse): GCCTCCTGTTGGTGAGAATCATG Origene Cat #: MP212229 Recombinant DNA AAV9-CASI-sTWEAK Biogen N/A AAV9-CASI-mCherry Biogen N/A pCAG-mCherry In-house N/A Software and Algorithms ImageJ NIH https://fiji.sc/ or https://imagej.nih.gov/ij/ Prism Graphpad version 7.0b; RRID:SCR_002798 Neurolucida Microbrightfield RRID:SCR_001775 Imaris Bitplane ImarisColoc Metamorph Molecular Devices Version 1.0 Odyssey infrared imaging system Li-Cor biosciences Version 3.0 CATMAID Saalfeld et al., 2009 https://catmaid.readthedocs.io/en/stable/ iTK-SNAP Yushkevich et al., 2006 http://www.itksnap.org/pmwiki/pmwiki.php AlignTK N/A http://mmbios.pitt.edu/installation STRING Szklarczyk et al., 2019 https://string-db.org/ Other FISH probe: C1qa, Channel 3 ACDBio Cat # 441221-C3 FISH probe: Cx3cr1, Channel 2 ACDBio Cat # 314221-C2 FISH probe: Olig1, Channel 3 ACDBio Cat # 480651-C3 FISH probe: Aldh1l1, Channel 2 ACDBio Cat # 405891-C2 FISH probe: Cldn5, Channel 3 ACDBio Cat # 491611-C3 FISH probe: Tnfrsf12a (Fn14), Channel 3 ACDBio Cat # 505311-C3 FISH probe: P2ry12, Channel 2 ACDBio Cat # 317601-C2 FISH probe: Vglut2, Channel 2 ACDBio Cat # 319171-C2 FISH probe: Tnfsf12 (TWEAK), Channel 1 ACDBio Cat # 552051 FISH probe: Aldoc, Channel 3 ACDBio Cat # 429531-C3 e2 Neuron 108, 451–468.e1–e9, November 11, 2020

Techniques: Infection, Expressing, Comparison, Recombinant, Immunostaining, Western Blot, Marker, Control

Figure 8. Model of TWEAK/Fn14-Dependent Synapse Regulation during Experience-Dependent Refinement (A) Schematic of retinal inputs (orange) converging onto the dendrites of a relay neuron (teal). Alone, Fn14 increases bulbous spines to strengthen and maintain synapses, whereas TWEAK binding at other synapses leads to their ultimate disassembly. In the absence of experience, neither TWEAK nor Fn14 is expressed, so neither of these processes occur, and synapses remain in a weakened state but are not properly removed. (B) We propose that the SD period of postsynaptic regulation by microglia identified in this study constitutes a later phase of microglia-driven circuit sculpting that follows earlier phases of phagocytic pruning and is driven by distinct molecular mechanisms.

Journal: Neuron

Article Title: Sensory Experience Engages Microglia to Shape Neural Connectivity through a Non-Phagocytic Mechanism.

doi: 10.1016/j.neuron.2020.08.002

Figure Lengend Snippet: Figure 8. Model of TWEAK/Fn14-Dependent Synapse Regulation during Experience-Dependent Refinement (A) Schematic of retinal inputs (orange) converging onto the dendrites of a relay neuron (teal). Alone, Fn14 increases bulbous spines to strengthen and maintain synapses, whereas TWEAK binding at other synapses leads to their ultimate disassembly. In the absence of experience, neither TWEAK nor Fn14 is expressed, so neither of these processes occur, and synapses remain in a weakened state but are not properly removed. (B) We propose that the SD period of postsynaptic regulation by microglia identified in this study constitutes a later phase of microglia-driven circuit sculpting that follows earlier phases of phagocytic pruning and is driven by distinct molecular mechanisms.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: B6.129P2(Cg)-Cx3cr1tm1Litt/J The Jackson Laboratory 005582; RRID:IMSR_JAX:005582 Mouse: Slc17a6tm2(cre)Lowl/J The Jackson Laboratory 028863; RRID:IMSR_JAX:016963 Mouse: Tg(Prkcd-glc-1/CFP,-Cre) Haubensak et al., 2010 N/A Mouse: B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J The Jackson Laboratory 007914; RRID:IMSR_JAX:007914 Mouse: Tg(Chx10-EGFP/cre,-ALPP)2Clc/J The Jackson Laboratory 005105; RRID:IMSR_JAX:005105 Mouse: B6J.B6N(Cg)-Cx3cr1tm1.1(cre)Jung/J The Jackson Laboratory 025524; RRID:IMSR_JAX:025524 Mouse: B6.C1qa(KO) Lab of Beth Stevens N/A Oligonucleotides qPCR primer: Gapdh (Forward): GGGTGTGAACCACG AGAAATA Origene Cat #: MP205604 qPCR primer: Gapdh (Reverse): CTGTGGTCATGAG CCCTTC Origene Cat #: MP205604 qPCR primer: Tnfsf12 (TWEAK) (Forward): GCTGGGC AACGCTGTCT Biogen N/A qPCR primer: Tnfsf12 (TWEAK) (Reverse): GCGGTCC TCTGCTGTCA Biogen N/A qPCR: Cx3cr1 (Forward): GAGCATCACTGACATCTACCTCC Origene Cat #: MP202408 qPCR: Cx3cr1 (Reverse): AGAAGGCAGTCGTGAGCTTGCA Origene Cat #: MP202408 qPCR: P2ry12 (Forward): CATTGACCGCTACCTGAAGACC Origene Cat #: MP212229 qPCR: P2ry12 (Reverse): GCCTCCTGTTGGTGAGAATCATG Origene Cat #: MP212229 Recombinant DNA AAV9-CASI-sTWEAK Biogen N/A AAV9-CASI-mCherry Biogen N/A pCAG-mCherry In-house N/A Software and Algorithms ImageJ NIH https://fiji.sc/ or https://imagej.nih.gov/ij/ Prism Graphpad version 7.0b; RRID:SCR_002798 Neurolucida Microbrightfield RRID:SCR_001775 Imaris Bitplane ImarisColoc Metamorph Molecular Devices Version 1.0 Odyssey infrared imaging system Li-Cor biosciences Version 3.0 CATMAID Saalfeld et al., 2009 https://catmaid.readthedocs.io/en/stable/ iTK-SNAP Yushkevich et al., 2006 http://www.itksnap.org/pmwiki/pmwiki.php AlignTK N/A http://mmbios.pitt.edu/installation STRING Szklarczyk et al., 2019 https://string-db.org/ Other FISH probe: C1qa, Channel 3 ACDBio Cat # 441221-C3 FISH probe: Cx3cr1, Channel 2 ACDBio Cat # 314221-C2 FISH probe: Olig1, Channel 3 ACDBio Cat # 480651-C3 FISH probe: Aldh1l1, Channel 2 ACDBio Cat # 405891-C2 FISH probe: Cldn5, Channel 3 ACDBio Cat # 491611-C3 FISH probe: Tnfrsf12a (Fn14), Channel 3 ACDBio Cat # 505311-C3 FISH probe: P2ry12, Channel 2 ACDBio Cat # 317601-C2 FISH probe: Vglut2, Channel 2 ACDBio Cat # 319171-C2 FISH probe: Tnfsf12 (TWEAK), Channel 1 ACDBio Cat # 552051 FISH probe: Aldoc, Channel 3 ACDBio Cat # 429531-C3 e2 Neuron 108, 451–468.e1–e9, November 11, 2020

Techniques: Binding Assay